Have a personal or library account? Click to login
Molecular and morphological characterization of Avenae-group cyst nematodes (Heteroderidae) from Greece Cover

Molecular and morphological characterization of Avenae-group cyst nematodes (Heteroderidae) from Greece

Open Access
|Mar 2025

Figures & Tables

Figure 1:

Photomicrographs of J2 showing lip region (top row) and tail regions (bottom) of Heterodera species (Avenae group) from Greece. (A, B) H. filipjevi; (C, D) H. hordecalis; (E, F) H. mani. Scale bar: 10 μm.
Photomicrographs of J2 showing lip region (top row) and tail regions (bottom) of Heterodera species (Avenae group) from Greece. (A, B) H. filipjevi; (C, D) H. hordecalis; (E, F) H. mani. Scale bar: 10 μm.

Figure 2:

Photomicrographs of vulva cones of cyst showing vulva fenestra (all bifenstrate), vulva slit, bullae, and underbridge of Heterodera species, Avenae group. Heterodera filipjevi: (A) vulval slit (arrow) and underbridge; (B) Bullae (arrow); H. hordecalis: (C) vulval slit (arrow) and strong underbridge with bifurcate ends (arrow); (D) Bullae absent; H. mani: (E) vulval slit (arrow) and underbridge; (F) bullae (arrow). Images were captured at different focal planes to emphasize diagnostic features. Scale bars, A, B, D, 10μm; C, E, F, 20 μm.
Photomicrographs of vulva cones of cyst showing vulva fenestra (all bifenstrate), vulva slit, bullae, and underbridge of Heterodera species, Avenae group. Heterodera filipjevi: (A) vulval slit (arrow) and underbridge; (B) Bullae (arrow); H. hordecalis: (C) vulval slit (arrow) and strong underbridge with bifurcate ends (arrow); (D) Bullae absent; H. mani: (E) vulval slit (arrow) and underbridge; (F) bullae (arrow). Images were captured at different focal planes to emphasize diagnostic features. Scale bars, A, B, D, 10μm; C, E, F, 20 μm.

Figure 3:

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes.
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes.

Figure 4:

Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes. The sequence MG523083* in haplotype HfA10 was determined to have originated from the Livadia, Greece population but was mistakenly attributed to Crete.
Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes. The sequence MG523083* in haplotype HfA10 was determined to have originated from the Livadia, Greece population but was mistakenly attributed to Crete.

Figure 5:

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. hordecalis populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. hordecalis populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.

Figure 6:

Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. hordecalis populations.
Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. hordecalis populations.

Figure 7:

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. mani populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. mani populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.

Figure 8:

Phylogenetic relationships of Heterodera Avenae group species from Greece inferred from partial Hsp90 genomic DNA sequence alignments analyzed by Bayesian Inference. Posterior probabilities are shown on appropriate branches. New sequences in bold.
Phylogenetic relationships of Heterodera Avenae group species from Greece inferred from partial Hsp90 genomic DNA sequence alignments analyzed by Bayesian Inference. Posterior probabilities are shown on appropriate branches. New sequences in bold.

Molecular similarity of 28S, ITS, mtCOI, and Hsp90 sequences obtained from Greek isolates of Avenae group species relative to existing sequences in GenBank_ Intraspecific variation refers to differences among sequences recovered from each new population_

MarkerSpecies nameHeterodera filipjeviHeterodera filipjeviHeterodera filipjeviHeterodera filipjeviHeterodera hordecalisHeterodera mani

SourcePotato fieldPotato fieldTurfgrassWheatPotato fieldGarlic field
Location, yearViotia Greece, M1 2013Livadia Greece, B12 2015Athens, Greece 2021Oregon, USA 2008Laconia, Greece M2, 2013Thiva, Greece 2021
28SPopulation Code86G96E115H35A86H116A
intraspecific variation*0 bp0 bp0 bp0 bp0 bp0 bp
closest GenBank hitGU083592MG859980MG859980GU083592LT159829OQ918098
H. filipjeviH. filipjeviH. filipjeviH. filipjeviH. hordecalisH. mani
ITScoverage100%100%100%99%100%98%
% identity100%100%100%99.7%100%100%
intraspecific variation*0 bp0–4 bp1–6 bp0 bp0–1 bp7–10 bp
closest GenBank hitMT254744MT254744MT254744MT254744MK840642MG523157
H. filipjeviH. filipjeviH. filipjeviH. filipjeviH. hordecalisH. mani
COIcoverage100%100%98%100%100%100%
% identity100%99.8%99.9%100%99.0%99.8%
intraspecific variation*0 bp0 bp0 bp1 bp2 bp0 bp
closest GenBank hitMG523083MK093059MK093059MK093059MG5232140MG523097
H. filipjeviH. filipjeviH. filipjeviH. filipjeviH. hordecalisH. mani
Hsp90coverage90%96%84%97%88%99%
% identity99.5%98.3%99.0%99.8%91.48%100%
intraspecific variation*3–64 bp0–16n/d12–24 bp4–9 bp0–11 bp
closest GenBank hitMH848608MH848608 MH848608JQ316192MH484608
H. avenaeH. avenae H. avenaeH. avenaeH. avenae
coverage93%93% 92%99%99%
% identity87.4%87.8% 86.9%82.9%92.6%

Main morphometric characters of J2 from Avenae-group of Heterodera species recovered during present study from Greece including H_ filipjevi, H_ hordecalis, and H_ mani_ All measurements except lateral lines are in micrometers (µm) and in the form of mean (range)_

Morphometric charactersH. filipjeviH. hordecalisH. mani
Body length552 (462–662)464 (417–525)552 (526–578)
Stylet25 (23–26)24 (23–26)25 (24–26)
Tail61 (53–68)57 (48–63)65 (61–67)
Hyaline tail41 (33–50)36 (31–41)41 (39–42)
Lateral lines444

GenBank accession numbers of DNA markers from Avenae-group species including H_ filipjevi H_ hordecalis and H_ mani generated for this study_

Species nameCodeHostLocation, yearGenBank accession numbers

28SITSmtCOIHsp90
Heterodera filipjevi86GPotato fieldViotia Greece, M1, 2013PQ098459-PQ098461PQ096808-PQ096810PQ096970, PQ096971PQ143935-PQ143941
96EPotato fieldLivadia Greece, B12, 2015PQ098464-PQ098467PQ096802-PQ096804PQ096975, PQ096976PQ143942-PQ143945
115HTurfgrassAthens, 2021PQ098468-PQ098470PQ096811-PQ096814PQ096972-PQ096974
35AWheatOregon, USA, 2008PQ098456-PQ098458PQ096805-PQ096807PQ096969, PQ096977PQ143930-PQ143934
Heterodera hordecalis86H1Potato fieldLaconia, Greece, M2, 2013PQ098462-PQ098463PQ096819-PQ096821PQ096964-PQ096965PQ143946-PQ143950
Heterodera mani116AGarlic fieldThiva, Greece, 2021PQ098471-PQ098472PQ096815-PQ096818PQ096966-PQ096968PQ143951-PQ143956

Primers used for PCR amplification of DNA markers from Heterodera spp_

MarkerPrimersSequence 5′→3′Primer and PCR References
28SD2AbACAAGTACCGTGAGGGAAAGTTGDe Ley et al., 2005
D3BTCGGAAGGAACCAGCTACTAYe et al., 2007
ITSTW81GTTTCCGTAGGTGAACCTGCJoyce et al., 1994
AB28ATATGCTTAAGTTCAGCGGGTSkantar et al., 2012
mtCOIHet-cox-1FTAGTTGATCGTAATTTTAATGGSubbotin, 2015
Het-cox-1RCCTAAAACATAATGAAAATGWGC
Hsp90U288GAYACVGGVATYGGNATGACYAASkantar and Carta, 2005
L1110TCRCARTTVTCCATGATRAAVAC
DOI: https://doi.org/10.2478/jofnem-2025-0008 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: Sep 23, 2024
|
Published on: Mar 19, 2025
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2025 Andrea M. Skantar, Zafar A. Handoo, Maria N. Hult, Alemayehu Habteweld, Maria Kormpi, Emannuel A. Tzortzakakis, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.